Troubleshooting

(The tutorial is here. The documentation is here.)

Here is some advice in case you get into trouble using PriFi. If this page doesn't help you, please visit the Helpdesk.

PriFi doesn't find any primers in my sequences

Have you marked the introns by inserting X'es in your sequences? If not, you should be running PriFi in general mode. By default it runs in intron mode; to run in general mode, click the "Configure" button, scroll down to the bottom and set the "Introns in sequences" parameter to "no". Note that you have to do this every time you wish to run it in general mode, before uploading any sequences.
In intron mode, at least one of your sequences must contain X'es. Each series of X'es is interpreted by PriFi as an intron. This means that you manually have to edit your sequence or alignment file (before uploading it) and insert X'es. See this section in the documentation.
Are your sequences phylogenetically too distant? You may want to align your sequences yourself taking codon information into account (thus aligning DNA but on the protein level) and upload this alignment, rather than simply uploading your sequences and have PriFi do the alignment. PriFi uses Clustalw which uses DNA sequence information only when aligning. For distantly related sequences an alignment based on codons might be better.
Also, try relaxing the criteria (see below).
Is your alignment fairly short? By default, PriFi looks for primers which yield a PCR product at least 450 base pairs long. If that's too long for your application, lower the "Minimum PCR product length" parameter.

What's a good way to relax the primer criteria?

Relaxing the criteria may lower the quality of any primers PriFi might find. However, if you think your alignment is good enough even though PriFi found no primers initially, you can relax the criteria after clicking the "Configure" button. Perhaps you simply disagree with some of the parameter settings defining "optimal" values; in that case you should of course alter them. Any changes to the default values have to be made every time you run PriFi and prior to uploading any file.

Does your alignment contain few highly conserved regions? Try decreasing the "Minimum conservation-% in conservation window" parameter. See here.

Are the conserved regions in your alignment short? Try decreasing the "Conservation window length" parameter. See here.
You might also consider increasing the "Maximum number of ambiguity positions" (see here) or decreasing the "Minimum length with two ambiguity positions" and "Minimum length with three or more ambiguity positions" parameters (see here and here).

Other than that you might look around on this page where all parameters are explained.

I have trouble uploading a file

Are you uploading an alignment file? Make sure it's in the Clustalw format. That means it (probably) has extension .aln. and looks something like this: CLUSTAL W (1.83) multiple sequence alignment s3 ----------TTTTGAGCTCTTTGACTTTTCATATCAGATTCTCAATATTGCAGAAGTGG s4 ----------TTTTGACACGTTTGACTTTTCATATCAGATTCTCAATATTGCAGAAGTGG s2 AGCAGCTGCATTTTGAGCTGTTTGACTTTTCATATCAGATCCTCAATATCGCAGAAGTGG s1wIntrons AACAGCTACATTTTGAGCTCTTTGACTTCTCGTATCAGATCCTCAATATCGCAGAAGTGG ****** ******** ** ******** ******** **********

Are you uploading a sequence file? Make sure it's in the Fasta format. That means each sequence is represented by a header line (a sequence name and possibly a description, preceded by a >) followed by the sequence data. For example:
>sequence1 CGTACGACTCGGCTACGACATCATGTCGTACGCGTACTGATCGTAC ACGATCGACGATCTATATATCGGCCGCC >sequence2 CGCGACAATCCGGATATATCGACTACGATCGTACTGAT

Go to the PriFi main page