
Troubleshooting
(The tutorial is here.
The documentation is here.)
Here is some advice in case you get into trouble using PriFi. If this page
doesn't help you, please visit the Helpdesk.
PriFi doesn't find any primers in my sequences
- Have you marked the introns by inserting X'es in your sequences? If not, you should be
running PriFi in general mode. By default it runs in
intron mode; to run in general mode, click the "Configure"
button, scroll down to the bottom and set the "Introns in sequences"
parameter to "no". Note that you have to do this every time you wish
to run it in general mode, before uploading any sequences.
In intron mode, at least one of your sequences must contain X'es. Each
series of X'es is interpreted by PriFi as an intron. This means that
you manually have to edit your sequence or alignment file (before
uploading it) and insert X'es. See this section in the documentation.
- Are your sequences phylogenetically too
distant? You may want to align your sequences yourself taking
codon information into account (thus aligning DNA but on the protein
level) and upload this alignment, rather than simply uploading your
sequences and have PriFi do the alignment. PriFi uses Clustalw which
uses DNA sequence information only when aligning. For distantly
related sequences an alignment based on codons might be better.
Also, try relaxing the criteria (see below).
- Is your alignment fairly short? By
default, PriFi looks for primers which yield a PCR product at least
450 base pairs long. If that's too long for your application, lower
the "Minimum PCR product length" parameter.
What's a good way to relax the primer criteria?
Relaxing the criteria may lower the quality of any primers PriFi might
find. However, if you think your alignment is good enough even though
PriFi found no primers initially, you can relax the criteria after
clicking the "Configure" button. Perhaps you simply disagree with some
of the parameter settings defining "optimal" values; in that case you
should of course alter them. Any changes to the default values have to
be made every time you run PriFi and prior to
uploading any file.
Other than that you might look around on this page where
all parameters are explained.
I have trouble uploading a file
- Are you uploading an alignment
file? Make sure it's in the
Clustalw format. That means it (probably) has extension .aln. and
looks something like this:
CLUSTAL W (1.83) multiple sequence alignment
s3 ----------TTTTGAGCTCTTTGACTTTTCATATCAGATTCTCAATATTGCAGAAGTGG
s4 ----------TTTTGACACGTTTGACTTTTCATATCAGATTCTCAATATTGCAGAAGTGG
s2 AGCAGCTGCATTTTGAGCTGTTTGACTTTTCATATCAGATCCTCAATATCGCAGAAGTGG
s1wIntrons AACAGCTACATTTTGAGCTCTTTGACTTCTCGTATCAGATCCTCAATATCGCAGAAGTGG
****** ******** ** ******** ******** **********
- Are you uploading a sequence
file? Make sure it's
in the Fasta format. That means each sequence is represented by a
header line (a sequence name and possibly a description,
preceded by a >) followed by the sequence data. For example:
>sequence1
CGTACGACTCGGCTACGACATCATGTCGTACGCGTACTGATCGTAC
ACGATCGACGATCTATATATCGGCCGCC
>sequence2
CGCGACAATCCGGATATATCGACTACGATCGTACTGAT
Go to the PriFi
main page